addgene numbers Search Results


93
Sino Biological plasmid
Plasmid, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid/product/Sino Biological
Average 93 stars, based on 1 article reviews
plasmid - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

88
Addgene inc pmsp3535
Pmsp3535, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmsp3535/product/Addgene inc
Average 88 stars, based on 1 article reviews
pmsp3535 - by Bioz Stars, 2026-05
88/100 stars
  Buy from Supplier

96
Addgene inc pspcas9 bb 2a gfp
Pspcas9 Bb 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pspcas9 bb 2a gfp/product/Addgene inc
Average 96 stars, based on 1 article reviews
pspcas9 bb 2a gfp - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

88
Addgene inc nlp 22
<t>nlp-22</t> is expressed in dynamic fashion in the RIA interneurons. ( a ) mRNA expression during larval development. Expression levels cycle in synchrony with each lethargus stage. Yellow circles depict each lethargus stage, as defined by cessation of feeding of the animals (Biological replicates per time point ≥3, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( b ) nlp-22 expression is increased in response to lin-42 over-expression during the adult stage. (*p<0.05, ** p<0.005, Student’s two-tailed t -Test, Biological replicates per condition ≥5, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( c ) An nlp-22 transcriptional GFP reporter is expressed in the RIA neurons (arrow). Intestinal auto-fluorescence is also observed (arrow head). Scale Bar = 5μM.
Nlp 22, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nlp 22/product/Addgene inc
Average 88 stars, based on 1 article reviews
nlp 22 - by Bioz Stars, 2026-05
88/100 stars
  Buy from Supplier

93
Addgene inc emmprin 2
<t>nlp-22</t> is expressed in dynamic fashion in the RIA interneurons. ( a ) mRNA expression during larval development. Expression levels cycle in synchrony with each lethargus stage. Yellow circles depict each lethargus stage, as defined by cessation of feeding of the animals (Biological replicates per time point ≥3, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( b ) nlp-22 expression is increased in response to lin-42 over-expression during the adult stage. (*p<0.05, ** p<0.005, Student’s two-tailed t -Test, Biological replicates per condition ≥5, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( c ) An nlp-22 transcriptional GFP reporter is expressed in the RIA neurons (arrow). Intestinal auto-fluorescence is also observed (arrow head). Scale Bar = 5μM.
Emmprin 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/emmprin 2/product/Addgene inc
Average 93 stars, based on 1 article reviews
emmprin 2 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc pcxle egfp
<t>nlp-22</t> is expressed in dynamic fashion in the RIA interneurons. ( a ) mRNA expression during larval development. Expression levels cycle in synchrony with each lethargus stage. Yellow circles depict each lethargus stage, as defined by cessation of feeding of the animals (Biological replicates per time point ≥3, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( b ) nlp-22 expression is increased in response to lin-42 over-expression during the adult stage. (*p<0.05, ** p<0.005, Student’s two-tailed t -Test, Biological replicates per condition ≥5, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( c ) An nlp-22 transcriptional GFP reporter is expressed in the RIA neurons (arrow). Intestinal auto-fluorescence is also observed (arrow head). Scale Bar = 5μM.
Pcxle Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcxle egfp/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcxle egfp - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

96
Addgene inc f zhang
<t>nlp-22</t> is expressed in dynamic fashion in the RIA interneurons. ( a ) mRNA expression during larval development. Expression levels cycle in synchrony with each lethargus stage. Yellow circles depict each lethargus stage, as defined by cessation of feeding of the animals (Biological replicates per time point ≥3, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( b ) nlp-22 expression is increased in response to lin-42 over-expression during the adult stage. (*p<0.05, ** p<0.005, Student’s two-tailed t -Test, Biological replicates per condition ≥5, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( c ) An nlp-22 transcriptional GFP reporter is expressed in the RIA neurons (arrow). Intestinal auto-fluorescence is also observed (arrow head). Scale Bar = 5μM.
F Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/f zhang/product/Addgene inc
Average 96 stars, based on 1 article reviews
f zhang - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

95
Addgene inc grna plasmid
(A) Design of <t>gRNA</t> targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout <t>of</t> <t>PrP</t> in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.
Grna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna plasmid/product/Addgene inc
Average 95 stars, based on 1 article reviews
grna plasmid - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

91
Addgene inc psfv helper1
(A) Design of <t>gRNA</t> targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout <t>of</t> <t>PrP</t> in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.
Psfv Helper1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/psfv helper1/product/Addgene inc
Average 91 stars, based on 1 article reviews
psfv helper1 - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

91
Addgene inc full length rabbit α 1s cdna
(A) Design of <t>gRNA</t> targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout <t>of</t> <t>PrP</t> in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.
Full Length Rabbit α 1s Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/full length rabbit α 1s cdna/product/Addgene inc
Average 91 stars, based on 1 article reviews
full length rabbit α 1s cdna - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

86
Addgene inc sihif 1α
(A) Design of <t>gRNA</t> targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout <t>of</t> <t>PrP</t> in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.
Sihif 1α, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sihif 1α/product/Addgene inc
Average 86 stars, based on 1 article reviews
sihif 1α - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

96
Addgene inc plenti cmv puromycin destination vector
(A) Design of <t>gRNA</t> targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout <t>of</t> <t>PrP</t> in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.
Plenti Cmv Puromycin Destination Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plenti cmv puromycin destination vector/product/Addgene inc
Average 96 stars, based on 1 article reviews
plenti cmv puromycin destination vector - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

Image Search Results


nlp-22 is expressed in dynamic fashion in the RIA interneurons. ( a ) mRNA expression during larval development. Expression levels cycle in synchrony with each lethargus stage. Yellow circles depict each lethargus stage, as defined by cessation of feeding of the animals (Biological replicates per time point ≥3, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( b ) nlp-22 expression is increased in response to lin-42 over-expression during the adult stage. (*p<0.05, ** p<0.005, Student’s two-tailed t -Test, Biological replicates per condition ≥5, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( c ) An nlp-22 transcriptional GFP reporter is expressed in the RIA neurons (arrow). Intestinal auto-fluorescence is also observed (arrow head). Scale Bar = 5μM.

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: nlp-22 is expressed in dynamic fashion in the RIA interneurons. ( a ) mRNA expression during larval development. Expression levels cycle in synchrony with each lethargus stage. Yellow circles depict each lethargus stage, as defined by cessation of feeding of the animals (Biological replicates per time point ≥3, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( b ) nlp-22 expression is increased in response to lin-42 over-expression during the adult stage. (*p<0.05, ** p<0.005, Student’s two-tailed t -Test, Biological replicates per condition ≥5, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( c ) An nlp-22 transcriptional GFP reporter is expressed in the RIA neurons (arrow). Intestinal auto-fluorescence is also observed (arrow head). Scale Bar = 5μM.

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Expressing, Over Expression, Two Tailed Test, Fluorescence

NLP-22 induces behavioral quiescence. ( a ) Gene and protein structure of nlp-22 including over-expression construct. 2.5 hours after nlp-22 induction, animals show reduced movement ( b ) and feeding ( c ) relative to control animals over-expressing GFP (strain: TJ375). ( c ) Removing the signal sequence, or mutating the KR or FRPG eliminates the ability of NLP-22 to reduce pumping rate (**p<0.0001, Student’s two-tailed t -Test, N≥20). ( d ) Animals over-expressing nlp-22 cease pumping, but recover 9 hours after heat-shock (*p<0.001, **p<0.0001, Fisher’s exact test, N≥20 animals, 2 trials; Error bars represent s.e.m.).

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: NLP-22 induces behavioral quiescence. ( a ) Gene and protein structure of nlp-22 including over-expression construct. 2.5 hours after nlp-22 induction, animals show reduced movement ( b ) and feeding ( c ) relative to control animals over-expressing GFP (strain: TJ375). ( c ) Removing the signal sequence, or mutating the KR or FRPG eliminates the ability of NLP-22 to reduce pumping rate (**p<0.0001, Student’s two-tailed t -Test, N≥20). ( d ) Animals over-expressing nlp-22 cease pumping, but recover 9 hours after heat-shock (*p<0.001, **p<0.0001, Fisher’s exact test, N≥20 animals, 2 trials; Error bars represent s.e.m.).

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Over Expression, Construct, Expressing, Sequencing, Two Tailed Test

Quiescence induced by nlp-22 OE resembles lethargus quiescence. ( a ) Animals that over-express nlp-22 (strain: NQ251) are less responsive to chemical (1-octanol) and optical (blue light) stimulation than control animals that over-express GFP (strain: TJ375) (**p<0.0001, Student’s two-tailed t -Test, N≥20; Error bars represent s.e.m.). ( b ) Over-expressing nlp-22 via a mild heat shock, such that full quiescence is not induced, results in increased backwards movement. White, dark gray, and light gray denote forward, backwards, and no movement, respectively. The average fraction of time spent moving forward or moving backward in a 120s window for nlp-22 over-expressing animals is significantly different from WT worms (*p<0.001. **p<0.0001, Student’s two-tailed t -Test, N=20). In addition to the bias for backwards motion, nlp-22 over-expressing animals also moved significantly less than WT animals (**p<0.0001, Student’s two-tailed t -Test, N=20).

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: Quiescence induced by nlp-22 OE resembles lethargus quiescence. ( a ) Animals that over-express nlp-22 (strain: NQ251) are less responsive to chemical (1-octanol) and optical (blue light) stimulation than control animals that over-express GFP (strain: TJ375) (**p<0.0001, Student’s two-tailed t -Test, N≥20; Error bars represent s.e.m.). ( b ) Over-expressing nlp-22 via a mild heat shock, such that full quiescence is not induced, results in increased backwards movement. White, dark gray, and light gray denote forward, backwards, and no movement, respectively. The average fraction of time spent moving forward or moving backward in a 120s window for nlp-22 over-expressing animals is significantly different from WT worms (*p<0.001. **p<0.0001, Student’s two-tailed t -Test, N=20). In addition to the bias for backwards motion, nlp-22 over-expressing animals also moved significantly less than WT animals (**p<0.0001, Student’s two-tailed t -Test, N=20).

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Two Tailed Test, Expressing

nlp-22 is required for normal quiescence during lethargus. ( a ) Fraction of quiescence in a 10-minute moving window in a wild-type animal, an nlp-22(gk509904) mutant, and an nlp-22 ( gk509904 ) mutant carrying an nlp-22 genomic rescuing transgene. The x-axis is hours from the start of recording in the late third larval stage. ( b ) Quiescence in animals expressing double stranded nlp-22 RNA in the hypodermis and in the RIA neurons. Average quiescence (*p<0.05, **p<0.01, ***p<0.001, Student’s two-tailed t -Test; N≥10, Error bars represent s.e.m.), ( c ) and response latencies to blue light ( d ) during fourth larval stage lethargus (***p<0.001, Student’s two-tailed t -Test; N≥28 animals, Error bars represent s.e.m.).

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: nlp-22 is required for normal quiescence during lethargus. ( a ) Fraction of quiescence in a 10-minute moving window in a wild-type animal, an nlp-22(gk509904) mutant, and an nlp-22 ( gk509904 ) mutant carrying an nlp-22 genomic rescuing transgene. The x-axis is hours from the start of recording in the late third larval stage. ( b ) Quiescence in animals expressing double stranded nlp-22 RNA in the hypodermis and in the RIA neurons. Average quiescence (*p<0.05, **p<0.01, ***p<0.001, Student’s two-tailed t -Test; N≥10, Error bars represent s.e.m.), ( c ) and response latencies to blue light ( d ) during fourth larval stage lethargus (***p<0.001, Student’s two-tailed t -Test; N≥28 animals, Error bars represent s.e.m.).

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Mutagenesis, Expressing, Two Tailed Test

NLP-22-induced quiescence requires the protein kinase A subunit KIN-2. Feeding ( a ) and locomotion ( b ) quiescence induced by nlp-22 over-expression is impaired in kin-2 mutants (*p<0.0001, Fisher’s exact test, N>20 animals, 2 trials; Error bars represent s.e.m.). Unfilled bars represent animals of genotype qnIs142 [P hsp-16.2:nlp-22; P hsp-16.2:gfp; P myo-2:mCherry; unc-119 ( + )] and filled bars represent animals of genotype qnIs142; kin-2 ( ce179 )X.

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: NLP-22-induced quiescence requires the protein kinase A subunit KIN-2. Feeding ( a ) and locomotion ( b ) quiescence induced by nlp-22 over-expression is impaired in kin-2 mutants (*p<0.0001, Fisher’s exact test, N>20 animals, 2 trials; Error bars represent s.e.m.). Unfilled bars represent animals of genotype qnIs142 [P hsp-16.2:nlp-22; P hsp-16.2:gfp; P myo-2:mCherry; unc-119 ( + )] and filled bars represent animals of genotype qnIs142; kin-2 ( ce179 )X.

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Over Expression

NLP-22 is similar to Neuromedin S. ( a ) Alignment of NLP-22 preproprotein with orthologs from four nematode species. High conservation (gray box) is observed in the predicted neuropeptide sequence. ( b ) Amino acid sequence similarities (gray boxes) between NLP-22 and vertebrate Neuromedin S peptides. The preproprotein structure of human Neuromedin S and NLP-22 is also shown. Each has an N-terminal signal sequence and a single, c-terminal peptide. The preproprotein is drawn to scale (Bar = 10 Amino Acids) ( c ) Predicted structures of NLP-22 and of NMS. The conserved GR dipeptide and FRP tripeptide motifs are shown in white.

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: NLP-22 is similar to Neuromedin S. ( a ) Alignment of NLP-22 preproprotein with orthologs from four nematode species. High conservation (gray box) is observed in the predicted neuropeptide sequence. ( b ) Amino acid sequence similarities (gray boxes) between NLP-22 and vertebrate Neuromedin S peptides. The preproprotein structure of human Neuromedin S and NLP-22 is also shown. Each has an N-terminal signal sequence and a single, c-terminal peptide. The preproprotein is drawn to scale (Bar = 10 Amino Acids) ( c ) Predicted structures of NLP-22 and of NMS. The conserved GR dipeptide and FRP tripeptide motifs are shown in white.

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Sequencing

Model for role of nlp-22 and RIA in sleep-like quiescence regulation. LIN-42 functions in as yet unidentified larval clock cells to regulate nlp-22 expression as well as other quiescence-regulatory factors. Release of NLP-22 neuropeptide promotes sleep-like behavior via a reduction of protein kinase A (PKA) activity. RIA membrane depolarization (marked with the letter V) results in the release of an unidentified wake-promoting neurotransmitter.

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: Model for role of nlp-22 and RIA in sleep-like quiescence regulation. LIN-42 functions in as yet unidentified larval clock cells to regulate nlp-22 expression as well as other quiescence-regulatory factors. Release of NLP-22 neuropeptide promotes sleep-like behavior via a reduction of protein kinase A (PKA) activity. RIA membrane depolarization (marked with the letter V) results in the release of an unidentified wake-promoting neurotransmitter.

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Expressing, Activity Assay

(A) Design of gRNA targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout of PrP in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.

Journal: PLoS ONE

Article Title: The cellular prion protein interacts with and promotes the activity of Na,K-ATPases

doi: 10.1371/journal.pone.0258682

Figure Lengend Snippet: (A) Design of gRNA targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout of PrP in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.

Article Snippet: Briefly, the selected gRNA human PrP ( CACTGGGGGCAGCCGATACCCGG ) was cloned into the gRNA plasmid (catalog number MLM3636, Addgene, MA, USA) following digestion with the BsmBI enzyme (catalog number R0580S, New England BioLabs, MA, USA) and verified by Sanger sequencing.

Techniques: Sequencing, CRISPR, Knock-Out, Biomarker Discovery, Standard Deviation, Infection, Two Tailed Test